Medio Ambiente y Desarrollo Sustentable

Artículo arbitrado

Antibacterial activity of mexican oregano essential

oil (Lippia berlandieri) against the phytopathogenic

bacterium Xanthomonas euvesicatoria

Actividad antibacteriana del aceite esencial de orégano (Lippia berlandieri)

contra la bacteria fitopatógena Xanthomonas euvesicatoria

1

3,4

2

ALBA CHAVEZ-DOZAL , HUGO A. MORALES-MORALES , SOUM SANOGO ,

3

1

ARMANDO SEGOVIA-LERMA AND GEOFFREY B. SMITH

Recibido: Febrero 11, 2011

Aceptado: Enero 11, 2012

Abstract

Resumen

Xanthomonas euvesicatoria causes bacterial spot disease in

leaves, roots, fruits and stems of pepper plants. Identification

of this phytopathogen in jalapeno seeds from Delicias,

Chihuahua, Mexico and diseased plants from New Mexico,

USA, was carried out by isolation on semiselective media,

pathogenicity assays and biochemical tests. Mexican oregano

Xanthomonas euvesicatoria es la bacteria agente causal de la

marchitez bacteriana en hojas, raíces y frutos de chile jalapeño. Se

realizó la identificación de este patógeno en las semillas de chile

jalapeño provenientes de Delicias, Chihuahua, México y plantas

enfermas provenientes del estado de Nuevo Mexico, EUA; a través

de cultivo en medios semi-selectivos, ensayos de patogenicidad y

pruebas bioquímicas. El aceite esencial del orégano mexicano

(Lippia berlandieri) fue probado in vitro contra Xanthomonas

euvesicatoria. Pruebas de concentración mínima inhibitoria (CMI) y

concentración mínima bactericida (CMB) fueron determinadas y el

aceite mostró una inhibición de crecimiento a concentraciones de

0.01 mg/ml y un efecto bactericida a concentraciones de 0.05 mg/

ml. El aceite esencial de orégano muestra actividades

antibacterianas gracias al efecto de la alta concentración de

carvacrol. El aceite de orégano mostró una CMI que fue 10 veces

menor en comparación con el efecto de carvacrol puro, ya que la

concentración determinada en el aceite por medio de cromatografía

de gases/espectrometría de masas (GC/MS) fue de 30% de

carvacrol. El efecto antibacteriano in vivo fue probado utilizando un

diseño de bloques completos al azar en un invernadero. La severidad

e incidencia de la enfermedad, así como los índices de clorofila,

fueron calculados mostrando una inhibición de la enfermedad cuando

las semillas u hojas de las plantas de chile se trataron con el aceite

de orégano. Estos resultados demuestran la problemática de la

bacteria Xanthomonas en las fronteras México-Americanas y que

el aceite esencial de orégano ejerce una acción antibacteriana.

(

Lippia berlandieri) essential oil was tested in vitro against

Xanthomonas euvesicatoria. Minimum inhibitory concentration

MIC) and minimum bactericidal concentration (MBC) were

(

performed and the oil showed an inhibition of bacterial growth

in concentrations of 0.01 mg/ml and a bactericidal effect in

concentrations of 0.05 mg/ml. Oregano essential oil is reported

to have antimicrobial activities due to the effect of high content

of carvacrol. Oregano oil had an MIC that was 10 times lower

compared to pure carvacrol, since carvacrol content,

measured by gas chromatography/mass spectrometry (GC/

MS) was only 30%. The antimicrobial effect in vivo was tested

using a randomized complete block design model in a

greenhouse. Disease severity, xanthomonad incidence as well

as chlorophyll indices were calculated showing a strong

inhibition of the disease, when seeds or foliage were treated

with oregano oil. These results demonstrate the current

commonality of xanthomonad pathogens on both sides of the

Mexican-American border, and that oregano oil has potent

antibacterial activity.

Keywords: bacterial spot, minimim inhibory concentration,

Carvacrol.

Palabras clave: marchitez bacteriana, concentración mínima

inhibitoria, Carvacrol.

_

________________________________

1

2

3

4

Biology Department, New Mexico State University, Las Cruces, New Mexico, USA.

Enthomology, Plant pathology and Weed science Department, New Mexico State University, Las Cruces, New Mexico, USA.

Facultad de Ciencias Agricolas y Forestales, Universidad Autonoma de Chihuahua, Chihuahua, Mexico.

Dirección electrónica del autor de correspondencia: hugmoral2@yahoo.com.

1

09

•

Vol. VIII, Núm. 2 • Mayo-Agosto 2014 •

ALBA CHAVEZ-DOZAL, HUGO A. MORALES-MORALES, SOUM SANOGO, ARMANDO SEGOVIA-LERMA AND GEOFFREY B. SMITH: Antibacterial activity of

mexican oregano essential oil (Lippia berlandieri) against the phytopathogenic bacterium Xanthomonas euvesicatoria

Introduction

anthomonas euvesicatoria, also called Xanthomonas campestris pv. vesicatoria, has

been identified as the causal agent of the disease known as bacterial leaf spot

X

(Pohronesny et al., 1990; Bouzar et al., 1994; Kuflom and Diane, 1997; Ji-Liang and

Orser, 2004). Bacterial spot is a destructive disease of pepper in climates with high

temperatures and frequent rainfall (Pohronesny et al., 1990; Vorholter et al., 2008); seeds can

be infested and serve as a major source of inoculum for bacterial spot, as well as the means

for the long distance spread of the pathogen (Kuflom and Diane, 1997; Sanogo and Clary,

2008).

Bacterial leaf spot can cause serious yield

Since ancient times, plant extracts including

essential oils, have been used for a wide variety

of purposes including their use as antimicrobials

(Aureli et al., 1992; Biondi et al., 1993; Dorman

and Deans, 2000; Chorianopupolos et al., 2004;

Chorianoupolos et al., 2006). Essential oils have

been screened for their potential applications as

alternative remedies for many infectious

diseases, and have been shown to possess

antibacterial, antifungal, antiviral, insecticidal and

antioxidant properties (Dorman and Deans,

loss in pepper crops through plant defoliation

and fruit drop (Sanogo and Clary, 2008). This

disease has a major economic impact in both

the United States and Mexico. In northern

Mexico, the disease has had an effect on quality

and quantity of the fruit, resulting in a significant

impact on market standards causing loses

greater than nine million U.S. dollars (Velasquez-

Valle and Amador-Ramirez, 2007).

Factors such as humidity, rainfall and wind

play an important role in the occurrence of

bacterial spot. It has also been reported that the

pathogen can survive on dried seeds for many

years and in infected crop debris in the soil

2000). Mexican oregano (Lippia berlandieri) has

been proven to show in vitro potent antimicrobial

activity (Portillo-Ruiz et al., 2005). The

monoterpenic phenol carvacrol is the main

constituent of commercial oreganos and should

be given special emphasis since it

demonstrates low toxicity and surprisingly broad

antimicrobial activity (Chorianoupolos et al.,

(

Andrade et al., 2008). At present, disease

management practices using either antibiotics or

pesticides, have been banned due to their

undesirable attributes such as long degradation

time, bioaccumulation and chronic and acute

toxicity (Baricevic et al., 2001;Abbasi et al., 2002).

Other treatments that have been used recently

include copper sprays and plant activators

2006). This simple molecule is promising for the

development of effective disease treatment not

only in humans, but also for animals and plants

(

Veldhuzen et al., 2001). Mexican oregano is

mainly composed of carvacrol; however, the

antimicrobial activity is also attributed to other

phenolic compounds found in the oil such as

thymol and cymene (Vernin et al 2001), and

potent antibacterial activity might be attributed

to a synergistic action of these compounds.

(

Abbasi et al., 2002), which are effective but

sometimes induce systematic resistance. In

addition to the toxic effects in the treatment of

infectious plant diseases, pharmaceutical

antibiotics are simple substances that show

single modes of action and microbial resistance

is easily developed (Elgayyar and Draughon,

Few studies have focused on documenting

the effectiveness of essential oil obtained from

the Mexican oregano Lippia species. The main

goal of this investigation was to evaluate the

antimicrobial effect of Lippia berlandieri

essential oil on in vitro MIC’s and in vivo against

2

001). Neither the use of antibiotics nor pesticides

provides satisfactory solutions to the persistent

incidence of bacterial leaf spot; therefore, there

is a need for alternative management of

pathogenic Xanthomonas euvesicatoria.

1

10

• Vol. VIII, Núm. 2 • Mayo-Agosto 2014 •

ALBA CHAVEZ-DOZAL, HUGO A. MORALES-MORALES, SOUM SANOGO, ARMANDO SEGOVIA-LERMA AND GEOFFREY B. SMITH: Antibacterial activity of

mexican oregano essential oil (Lippia berlandieri) against the phytopathogenic bacterium Xanthomonas euvesicatoria

Xanthomonas euvesicatoria, in order to

determine the potential of oregano oil as an

alternative treatment for bacterial spot and its

feasibility to replace the use of antibiotics and

pesticides.

L NaCl and 0.02% Tween 20) for 14 h at 4 °C.

Then, 0.1 ml of the extract was spread onto two

plates: Modified Tween medium B (mTMB, per

liter composition: bacto peptone 10g, H BO

3

0.1g, KBr 10g, CaCl anhydrous 0.25g, bacto

2

agar 15g, tween 80 10ml, cephalexin 65mg, 5-

fluorouracil 12mg, trobamycin sulphate 0.2mg,

nystatin 35mg), and yeast dextrose calcium

carbonate medium (YDC, per liter composition:

Materials and methods

Bacterial strains, isolation and identification

of Xanthomonas in pepper seeds. Four strains

of Xanthomonas euvesicatoria were used in this

study, three from New Mexico, USA, and one

from Chihuahua, Mexico. The new mexican

strains were obtained from different farms

located in New Mexico (kindly provided by Dr. S.

Sanogo, College of Agricultural and

Environmental Sciences; Entomology, Plant

Pathology and Weed Sciences NMSU); these

strains are named according to the farm from

which they were isolated (Table 1). The mexican

strain (Chihuahua, Mexico) was isolated from

infected jalapeno pepper seed provided by the

Cuerpo Academico CA-100 from Universidad

Autonoma de Chihuahua located in Chihuahua

Mexico.

yeast extract 10g, CaCO 20g, d-glucose 20g,

3

bacto agar 17g). It was necessary to dilute the

extract 1:100 to obtain less than 300 colonies

per plate. After plates were incubated at 28 °C

for 5 days, pale yellow, mucoid colonies typical

of Xanthomonas spp. developed, then they were

transferred to a new plate of mTMB and isolated

by the quadrant streaking technique. Isolated

strains were used for biochemical

characterization consisting of hydrolysis tests

(casein, starch, lipids, gelatin, and cellulose),

catalase production and oxidation/fermentation

of glucose, lactose, and sucrose. Biochemical

tests were incubated at 28 °C for 4-7 days, and

if after 7 days no growth or color reaction was

observed, the test was considered negative. In

addition, PCR amplification of the intergenic

Table 1. Bacterial strains used in this study.

16S-23S ribosomal gene (Forward primer 5’-

GTGCCAGCAGCCGCGGTAAT; Reverse

primer 5’- TACTCCACCGCTTGTGCGGG),

followed by sequencing (ABI3100) was carried

out to confirm strain identity. In addition ClustalW

algorithm was used for multiple sequence

alignment.

Strain

Host

Location

Alvarez farm

Chile pepper

Bell pepper

La Union, New Mexico

Chamberino, New Mexico

Deming, New Mexico

Chihuahua, Mexico

Provencio farm

Kasparian farm

Tula Seed strain

Pathogenicity assays were performed using

the seed isolates. Seedlings of a known

susceptible jalapeno pepper cultivar (Early

Jalapeno) were grown under greenhouse

conditions until the 2-3 true leaf stage (4 weeks

after germination); a small quantity of the

selected colonies was transferred to a culture

tube with 5 ml of nutrient broth; the inoculum

was adjusted to an optical density of 0.1 at 625

Jalapeno pepper

For isolation of the Mexican Tula seed

pathogen, the standardized method described

by the International Seed Federation was used

(

www.worldseed.org). This method focuses in

the detection of viable Xanthomonas campestris

pv. vesicatoria (Xanthomonas euvesicatoria) by

dilution plating of seed extracts on semi-selective

media, and the confirmation of suspected

bacterial colonies by a pathogenicity assay. One

gram of seeds were incubated in 3 ml of seed

8

nm (ca. 10 CFU/ml).

Three leaves were infiltrated (1-4 sq cm of

the surface) with the suspension by gently

forcing the liquid into the adaxial surface of a

leaf using a sterile syringe without a needle;

extraction buffer (0.05M PO buffer pH 7.2; 8.5g/

4

1

11

•

Vol. VIII, Núm. 2 • Mayo-Agosto 2014 •

ALBA CHAVEZ-DOZAL, HUGO A. MORALES-MORALES, SOUM SANOGO, ARMANDO SEGOVIA-LERMA AND GEOFFREY B. SMITH: Antibacterial activity of

mexican oregano essential oil (Lippia berlandieri) against the phytopathogenic bacterium Xanthomonas euvesicatoria

sterile distilled water was used for the negative

control as previously described by the

International Seed Federation (ISF, http://

www.worldseed.org/isf/home.html). Inoculated

plants were incubated in a growth chamber at

microtiter dish (Corning 96 well plates, Sigma-

Aldrich, CLS3628). Varying concentrations (but

constant volumes) of oregano oil were added

(using five wells per strain); the plates were

covered and incubated at 37 °C in an orbital

shaker for 18 h. After incubation, microplates

were read at 625 nm in a plate reader (Bio-tek

FL 800). Non-inoculated controls and DMSO and

methanol blanks were also assayed. Before and

after exposure to oregano oil, viable plate counts

on Mueller Hinton Agar were carried out to

determine the MBC. These experiments were

repeated three times. The effect of pure

carvacrol (Carvacrol 98% Sigma-Aldrich No.

30 °C with 10 h light per day covered with a

plastic bag to retain and increase the humidity.

Plants were observed daily for one week looking

for the presence of chlorotic lesions. Non-

pathogenic bacteria will produce

a

hypersensitive reaction in 24 h or will not develop

lesions at all. This experiment was repeated to

ensure reproducibility in pathogenicity assays.

GC-MS analysis of Lippia berlandieri

essential oil. Oregano essential oil was obtained

by steam distillation and provided by the Don

Pablo Licon company located in Chihuahua,

Mexico. Dry leaves and small stems of L.

berlandieri were used for oil extraction.

Components were identified by direct

comparison with authentic standards (Sigma)

on the basis of retention time, Kovats retention

indices, and comparison with literature data

2

82197) against Xanthomonas euvesicatoria

strains was also carried out as described above

with the same number of replications.

Testing of Lippia berlandieri essential oil’s

effectiveness in disease protection.

a) Sources of infested pepper seed: Three

sets of seed were used (Table 2). The first set

consisted of naturally infested jalapeno seed

obtained from the diseased plant variety Tula

(Cuerpo Academico CA-100 from the

Universidad Autonoma de Chihuahua). The

second set, obtained from the cultivar Early

Jalapeno (Chile Pepper Institute, New Mexico

State University), was subdivided in two lots, and

seed in one lot was artificially infected with the

Mexican strain of X. euvesicatoria isolated from

the Mexican Tula seed, whereas seed in the

other lot was artificially infected with a strain from

New Mexico. Artificially infection of Early

Jalapeno seeds was carried out based on the

method proposed by Adam Bognadove, (2011)

(Adams, 2001).

Analysis of essential oil was performed by

gas chromatography coupled to mass

spectrometry using a CP-3800 Varian GS/MS.

The GC was equipped with a capillary column

Saturn 2200 (30 m x 0.25 mm fused silica

capillary column, film thickness 0.25 mm), and

Helium was used as a gas carrier at a flow rate

of 55 ml/min. The GC oven temperature was

initiated at 60 °C, then increased to 250 °C at a

rate of 3 °C/minute, and kept constant for 5 min

at 250 °C.

(

http://www.reu.iastate.edu/2002/papers/

Determination of the antibacterial activity of

Lippia berlandieri essential oil and pure carvacrol.

The minimum inhibitory concentration (MIC) and

minimum bactericidal concentration (MBC) of

essential oil was estimated. Pure bacterial

cultures were inoculated in 3 ml of Mueller Hinton

Broth (MHB, which is the medium recommen-

ded for this assay according to the International

Seed Federation) for 18 h at 37 °C, the culture

was adjusted to OD = 0.1 at 625 nm, and 150 μl

of each culture was added to a sterile 96-

DerrickBarker.pdf). Bacterial cultures were

grown in Nutrient Broth at 30 °C for 24 h; after

which the optical density was measured and

adjusted to 0.1. One gram of pepper seeds was

covered with a wet absorbent paper towel for

three hours using deionized sterile water. Seeds

were placed in a petri plate and mixed with 2 ml

of the 0.1 O.D₆₂₅bacterial suspension for 25 min;

this suspension was removed and the seeds

were allowed to dry for 1 h. The process was

repeated to ensure successful colonization.

1

12

• Vol. VIII, Núm. 2 • Mayo-Agosto 2014 •

ALBA CHAVEZ-DOZAL, HUGO A. MORALES-MORALES, SOUM SANOGO, ARMANDO SEGOVIA-LERMA AND GEOFFREY B. SMITH: Antibacterial activity of

mexican oregano essential oil (Lippia berlandieri) against the phytopathogenic bacterium Xanthomonas euvesicatoria

b) Seed treatment with Oregano oil: In order

to test the antibacterial activity of oregano oil,

different treatments were tested including both

seed and foliar treatments depending on the

seed variety as indicated in Table 2.

c) Assessment of treatment efficacy. The

variables disease severity/incidence index,

chlorophyll counting units, and matter yield were

measured to determine the efficacy of oil

treatment on disease development from

infested seeds: Disease severity (s) was

calculated using the Stover and Dickson scale.

Different grades were assigned to each leaf

according to the area spotted: grade 1 (< 5%

area spotted), grade 2 (5-15% area spotted),

grade 3 (16-33% area spotted), and grade 4 (>

Table 2. Treatments applied to seeds and plants of jalapeno

varieties Tula and Early. Note that Tula seeds were already

infected with a Mexican strain of Xanthomonas.

Jalapeno

variety

Target

Treatment

Identity or Procedure

Inected with ^aMX strain of

Xanthomonas

Tula

Seeds

Untreated (infected control)

33% area spotted). The proportion of diseased

Seeds

Bleach (0.57% free chlorine)

Oregano oil (1 mg/ml)

Immersed for 20 min

leaves, or disease incidence (I), was calculated

as the number of diseased leaves divided by

the total number of leaves in the plant.

Sprayed at 20 and 50

days after germination

Foliar

Oregano oil (1 mg/ml)

Oregano oil (0.1 mg/ml)

Sprayed at 20 and 50

days after germination

Chlorophyll was measured using CCM-200

chlorophyll content meter; each plant was

divided in three sections, three leaves from each

section were measured for chlorophyll and three

measurements from each leaf, corresponding

to a total of 27 measurements per plant.

Early

Seeds

Untreated (Non-infected control)

Inoculated with ^aMX strain

Inoculated with ^bNM strain

-

a

Inoculated with MX strain and

Oil sprayed at 20 and 50

days after germination

Seeds/Foliar

sprayed w/oregano oil (1 mg/ml)

_I_n_o_c_u_l_a_t_e_d_w_i_t_hbNM strain and

Oil sprayed at 20 and 50

sprayed w/oregano oil (1 mg/ml) days after germination

a

MX strain of Xanthomonas was isolated from Mexican-grown Tula seed.

NM strain of Xanthomonas was isolated from the Provencia farm, Las

Results and discussions

b

Cruces, NM.

Isolation and identification of Xanthomonas

euvesicatoria. Biochemical tests were perfor-

med on yellow mucoid colonies from the YDC

and mTMB media, and these resulted in positive

reactions for all bacterial strains (Table 3).

However, the time required to develop a positive

reaction was different between strains: Alvarez

and Kasparian strains developed positive

biochemical reactions after 6 days of incubation;

while Provencio and Tula Seed strains developed

positive reactions after 3 days of incubation.

Potted Early and Tula Jalapeno were placed

on a greenhouse bench in a randomized complete

block design with three replications. Plants were

covered with a plastic bag after the first foliar

delivery treatment in order to increase humidity

to encourage disease development. Plants were

watered every three days and observed everyday

to record any disease symptom.

After symptoms were detected, X.

euvesicatoria was isolated from diseased leaves

as follows: Five spots were cut from

symptomatic leaves with a razor blade and

macerated with a sterile mortar and pestle in 100

μl of sterile deionized water. The mixture was

centrifuged at 800 rpm for 1 min in order to

precipitate leaf debris and suspend bacterial cells

in the supernatant. A10 μl aliquot of supernatant

was streaked on a nutrient agar plate (please,

describe the composition of nutrient medium).

Plates were incubated for 5 days at 28 °C.

Biochemical tests (described previously) were

carried out for identification of the pathogen.

Amplification of the intergenic 16S-23S

ribosomal gene was carried out for all

presumptive xanthomonad strains, and the

presence of a 430 bp band was the first step

towards sequencing. BLAST results revealed that

X. euvesicatoria (no. GeneBank AM039952.1)

was a common match at the highest similarity

(98%) for all the isolates. Partial sequence of the

intergenic region was used to compare isolate

distribution (http://www.ebi.ac.uk/Tools/clustalw2/

index.html), and all the strains were unique from

each other (data not shown).

1

13

•

Vol. VIII, Núm. 2 • Mayo-Agosto 2014 •

ALBA CHAVEZ-DOZAL, HUGO A. MORALES-MORALES, SOUM SANOGO, ARMANDO SEGOVIA-LERMA AND GEOFFREY B. SMITH: Antibacterial activity of

mexican oregano essential oil (Lippia berlandieri) against the phytopathogenic bacterium Xanthomonas euvesicatoria

Table 3. Biochemical tests for the different Xanthomonas

euvesicatoria strains (W indicates a weak positive test).

In vitro determination of antibacterial activity

of Lippia berlandieri essential oil. Minimum

inhibitory (MIC) and bactericidal (MBC) activities

Xanthomonas euvesicatoria strains

X. euvesicatoria

Characteristic

were determined for each strain of X.

euvesicatoria. Bactericidal effects were

observed at higher concentrations (0.05 mg/ml)

whereas inhibition of growth (MIC) was observed

at concentrations of 0.01 mg/ml (Table 4) and

repeated experiments showed similar results.

(19)

Alvarez

Provencio

Kasparian

Tula

Medium yellow

mucoid circular

colonies, the halo

was absent.

Large yellow mucoid circular colonies, a

small crystalline halo around the yellow

colony was present.

Morphology in

mTMB media

Morphology in YDC

media

Medium yellow mucoid circular colonies.

Gram stain

Catalase production

Hydrolysis tests:

Casein

Gram-negative

+

Gram-negative rods of 2 m in size, commonly in pairs.

The effect of pure carvacrol on two different

X. euvesicatoria strains was tested (Provencio

and Tula). Interestingly, its antibacterial effect

was not as potent as oregano oil, despite the

fact that the oregano oil was measured to have

+

Starch

+

Lipids

W

+

W

+

W

3

0% of carvacrol content according to the GC/

MS data.

In vivo (in the plant host) determination of

Gelatin

Cellulose

+

O/F basal medium

Hugh Leifson)

(

antibacterial activity of Lippia berlandieri

Glucose oxidation

Lactose Oxidation

Sucrose Oxidation

Glucose

+

essential oil. Early jalapeno and Tula jalapeno

nd

varieties were planted on December 2 2007

+

following the seed treatments and foliar

applications described before. Plants were

examined three times per week for disease

symptoms, including chlorotic or necrotic zones

in leaves. The data collected is presented based

in observations of the leaves in each plant; total

number of diseased leaves were counted and

classified according to the severity of the disease

based on the parameters used by Chuang, 1987.

W

Fermentation

Lactose

Fermentation

+

W

+

Sucrose

Fermentation

Four weeks after germination, Early variety

of Jalapeno was inoculated with the four

xanthomonad isolates, but only two strains,

Provencio andTula, caused symptoms one week

after inoculation (Figure 1). The other two strains

and negative controls showed no symptoms.

Both virulent strains were re-isolated and verified

to be xanthomonads by biochemical tests.

To calculate the amount of leaf spot disease

severity (s) the modified Stover and Dickson

scale (Chuang and Jeger, 1987) was used:

s = (0.05x + 0.15y + 0.35z + 0.25 w) / n

in which x, y, z, and w represent the number

of leaves with disease grades 1, 2, 3 and 4

respectively, and n is the total number of leaves.

GC-MS analysis of Lippia berlandieri

essential oil.

Essential oil was analyzed with the purpose

of detecting the different components that were

present in the oregano oil; the chromatogram

The disease incidence (I), was calculated

as the number of diseased leaves divided by

the total number of leaves on the plant. Results

are summarized in Figures 3 and 4. When

severity indices are calculated, the range can

vary from 0 (absence of spots in the leaves) to

0.15 (medium severity/incidence index);

incidence varied from 0 (no diseased leaves)

(Figure 2) showed the seven major peaks that

represent the most prevalent components in the

essential oil. Total running time in the GS-MS

was of 63.3 min. The analysis was performed

in triplicate to ensure analytical repeatability.

1

14

• Vol. VIII, Núm. 2 • Mayo-Agosto 2014 •

ALBA CHAVEZ-DOZAL, HUGO A. MORALES-MORALES, SOUM SANOGO, ARMANDO SEGOVIA-LERMA AND GEOFFREY B. SMITH: Antibacterial activity of

mexican oregano essential oil (Lippia berlandieri) against the phytopathogenic bacterium Xanthomonas euvesicatoria

Table 4. MIC and MBC of different Xanthomonas euvesicatoria

strains when exposed to different concentrations of oregano

to 0.5 (the most severe index). When Early

jalapeno variety was inoculated with either the

(Lippia berlandieri) essential oil and carvacrol.

xanthomond isolates from Provencio, NM or

from Tula, plants exhibited disease symptoms

a_M_I_C_*

(mg/ml)

a_M_B_C_*_*

(mg/ml)

X. campestris

strains

Agent

(

Figure 4). When inoculated plants were

Alvarez

Oregano oil

0.01+0.005

0.01+0.004

0.05+0.005

0.05+0.006

sprayed twice with 1 mg/mL oregano oil (20

and 50 days post germination), disease

incidence and severity both significantly

dropped (Figure 4). The Tula jalapeno variety

developed bacterial spot symptoms without

inoculation due to the seeds already being

infected with Xanthomonas (Figure 5). When

oregano oil was applied to either the Tula seed

or to the foliage, disease symptoms decreased

significantly (Figure 4).

Provencio

Oregano oil

Carvacrol

0.01+0.004

0.10+0.020

0.05+0.006

1.00+0.082

Kasparian

Tula

Oregano oil

Carvacrol

0.01+0.00

0.05+0.005

1.5+0.064

0.10+0.0304

a

*

Values represent the means of three separate experiments

with + one standard deviation shown.

Significant inhibitory effect (p<0.01).

*

Significant bactericidal effect (p<0.001).

*

Figure 1. Pathogenicity assay. A=Alvarez strain, B=Kasparian strain, C=Provencio strain, D=Tula. Arrows indicate

the leaf that was inoculated.

1

15

•

Vol. VIII, Núm. 2 • Mayo-Agosto 2014 •

ALBA CHAVEZ-DOZAL, HUGO A. MORALES-MORALES, SOUM SANOGO, ARMANDO SEGOVIA-LERMA AND GEOFFREY B. SMITH: Antibacterial activity of

mexican oregano essential oil (Lippia berlandieri) against the phytopathogenic bacterium Xanthomonas euvesicatoria

Figure 2. Chromatogram of the oregano essential oil: «x» axes

indicates the retention time and «y» axes indicates the peak

height in K counts. Numbers indicate the analytes detected

oregano-treated plants (Figure 5). For example,

when the Early variety was infected with either

according to the retention time: Cyclohexene-1-methyl-4-

cymene (1), Cymeole (2), Carvacrol (3), Caryophyllene (4),

Caryophyllene oxide (5), Alpha-terpinene (6), 3-Carene (7).

Retention times matched with separately run standards, and

the mass spectra matched those in the Adams 2001 library.

the Tula or Provencio strain, chlorophyll content

decreased by a factor of 3, and when plants

were foliar treated with oil, chlorophyll content

increased to control levels in a two-fold order

(Figure 5A). Similar results were observed with

the Early variety (Figure 5B).

Figure 4. Severity and Incidence indices when Tula jalapeno

variety was treated with oregano oil. Values represent the

means of three replicates, and error bars represent one

standard deviation.

Figure 3. Severity and Incidence indices when Early jalapeno

variety was inoculated with Xanthomonas and then treated

with oregano oil. Values represent the means of three

replicates, and error bars represent one standard deviation.

*

Significant effect on Foliar treatment with 1 mg/ml when

comparing with controls (untreated seed and seed treated

with bleach) and foliar treatment at 0.1 mg/ml (p<0.01).

* Significant effect on Seeds treated with oregano oil when

compared with controls and foliar treatments (p<0.01).

Bacterial spot disease along the U.S.-

Mexican border in peppers and tomato has

represented a major problem in the last decade

causing crop losses with a serious economic

impact on producers. One of the goals of this

study was to isolate the causal agent of a spot

disease in pepper seeds, using the method

proposed by the International Seed Federation,

which involves the use of semi-selective media

*

Significant difference between infected plants and infected

plants that were foliar-treated (p<0.01).

In this greenhouse study, chlorophyll

content decreased by xanthomonad infection,

and chlorophyll content was maintained in

1

16

• Vol. VIII, Núm. 2 • Mayo-Agosto 2014 •

ALBA CHAVEZ-DOZAL, HUGO A. MORALES-MORALES, SOUM SANOGO, ARMANDO SEGOVIA-LERMA AND GEOFFREY B. SMITH: Antibacterial activity of

mexican oregano essential oil (Lippia berlandieri) against the phytopathogenic bacterium Xanthomonas euvesicatoria

and pathogenicity assays. Several methods

have been proposed as means for identification

X. euvesicatoria; one of which (Alvarez et al.,

using these techniques X. euvesicatoria was

isolated from the seeds and verified to be the

causal agent of the disease.

1

985) consists in producing monoclonal

Two other bacteria are likely to cause similar

symptoms to the ones caused by Xanthomonas

and biochemical tests are helpful to differentiate

them. Pseudomonas is an oxidative non-

fermentative bacterium, so the positive sugar

fermentations were helpful in eliminating this

possibility. Xylella has protease activity (capable

to hydrolyze casein and gelatin) (Fedatto, 2006),

the difference with Xanthomonas is that it is non

motile, does not ferment glucose and does not

produce lipase.

antibodies (MCAs) that rapidly identifies X.

campestris pv vesicaria from other pathovars.

In a different approach (17), X. campestris pv

campestris was detected using immuno-

fluorescence microscopy when polyclonal and

monoclonal antibodies were produced from

flagellar extracts, however, both methods

produced cross-reactivity with different non-

xanthomonad strains and with different

pathovars. Specific primers that detect specific

genes in the pathogen represent a promising

method. In this study, the amplification of the 16S

intergenic space sequences was used in

combination with sequence data, biochemical

tests, and the isolation protocol proposed by the

International Seed Federation. The combined

approach resulted in isolation and identification

of xanthomonads and allowed their screening

for virulence on pepper plant hosts. Tula variety

seeds were obtained during a Mexican outbreak

of bacterial spot on infected pepper plants, and

According to the results obtained in the

present investigation, among monoterpenes and

aromatic hydrocarbons detected in oregano oil,

cyclohexene-1-methyl-4-cymene was predominant

which was expected since it is a precursor of

carvacrol and thymol. Although carvacrol and

cymene were the major essential oil

components, 1-8-cineole and alpha-terpinene

were also present, consistent with other results

reported (Duschastki et al., 1999).

Figure 5. Chlorophyll content in infected Tula jalapeno variety (A) and in Early variety inoculated with the Tula and Provencio

xanthomonads (B), and effect of foliar and seed-applied oregano oil. Values represent the mean of three replicates, and standard

deviations were calculated using the unbiased estimator for the mean.

1

17

•

Vol. VIII, Núm. 2 • Mayo-Agosto 2014 •

ALBA CHAVEZ-DOZAL, HUGO A. MORALES-MORALES, SOUM SANOGO, ARMANDO SEGOVIA-LERMA AND GEOFFREY B. SMITH: Antibacterial activity of

mexican oregano essential oil (Lippia berlandieri) against the phytopathogenic bacterium Xanthomonas euvesicatoria

It has been reported that various agronomic

conditions such as duration of daylight,

temperature, water stress, and the plant growth

phase affect the development of the oregano

plant and its essential oil composition

diseases in plants, we depend on symptoms

and signs of the disease that can be measured

with different parameters described before

(severity/incidence indices, chlorophyll amount,

and dry weight).

(

Velasquez-Valle and Amador-Ramirez, 2007).

Seeds of the Early variety of jalapeno were

pathogen-free and were infected with strains that

exhibited virulence in both jalapeno and bell

peppers. The varieties were chosen for two

reasons: the first one was in order to test if the

method used to infect Early jalapeno seeds was

successful, and the second reason was to

compare if the treatments for avoiding disease

worked in both varieties.

For instance, water stress decreased fresh

weight and oil content while increasing thymol

and carvacrol content in the oil obtained from

Origanum vulgare species; flowering also

increased the oil yield (Stover and Dickson, 1970;

Vernin et al., 2001); young plants have a higher

amount of thymol whereas older plants have a

higher content of carvacrol (Stover and Dickson,

1

970). According to GC/MS analysis of this

Among the two types of infected seeds, the

incidence/severity indices were similar for both

native-infected seeds (Tula variety) and

inoculated (Early variety) with two different

strains, Early jalapeno inoculated with both

pathogenic strains, showed lower incidence/

severity indices than the already infected Tula

jalapeno when foliar treatment at the same

concentrations was applied.

study, carvacrol content in he oregano oil sample

corresponded to 30% (v/v) which is a significantly

higher amount when compared with essential

oil obtained from Origanum spp.

Previous work has demonstrated the

efficacy of oregano oil as antimicrobial, and most

of these studies have focused on the food

industry, testing the effects against some food-

borne pathogens as well as other human

pathogens (Aureli et al., 1992; Biondi et al.,

It can also be stated that the effect of the

extract is more effective at the seed level because

once the disease is present in adult plants; the

pathogen can be more resistant to treatment and

more difficult to control. It is also more convenient

in the sense that it does not consume as much

time as foliar treatment, and it is performed only

once with less quantity of essential oil.

1

993; Force et al., 2000; Baricevic et al., 2001;

Arcila-Lozano et al., 2004; Chorianoupolos et al.,

004; O’Mahony et al., 2005; Chorianoupolos et

2

al., 2006). Nevertheless, few studies have

considered the potential effect expected of

oregano essential oil against animal or plant

pathogens, specifically using Lippia essential oil

or other oregano-like plants.

When emphasizing strain virulence, as

observed in Figure 3, it seems that infection with

the Provencio isolate produces higher severity/

incidence than infection with the Tula seed isolate

for that particular variety of jalapeno; however,

to control both pathogens the single oil

concentrations appears to be equally effective

in eliminating pathogenesis, which indicates the

broad effectiveness of the oregano oil. Since

Xanthomonas euvesicatoria produces chlorosis

in leaf tissue, chlorophyll content was an

effective parameter to track infection. Chlorophyll

content changes represent both plant

xanthomonad infection and plant recovery due

to oregano oil treatment.

The concentration of oregano oil that is

needed to inhibit bacterial growth (MIC) and to

kill 99% of bacterial cells (MBC) is surprisingly

low, while the effect of pure phenol carvacrol is

not as effective as the oil (Table 4); this suggests

that the components found in oregano oil act

synergistically to potentially increase the

antimicrobial effect. Future studies are required

to test this hypothesis.

A plant disease, in its broad sense, is any

growth or developmental condition that is not

«normal» to that plant and can usually reduce

its economic or aesthetic value (Sanogo and

Clary, 2005). For a presumptive diagnosis of

1

18

• Vol. VIII, Núm. 2 • Mayo-Agosto 2014 •

ALBA CHAVEZ-DOZAL, HUGO A. MORALES-MORALES, SOUM SANOGO, ARMANDO SEGOVIA-LERMA AND GEOFFREY B. SMITH: Antibacterial activity of

mexican oregano essential oil (Lippia berlandieri) against the phytopathogenic bacterium Xanthomonas euvesicatoria

In summary, Koch’s postulates were proven

in that a xanthomonad was isolated from infected

seed (Tula), was inoculated on to healthy plants,

References

ABBASI, P.A., N. Soltani, D.A. Cuppels. and G. Lazarovitz. 2002.

Reduction of bacterial spot disease severity on tomato and

causing disease, and was re-isolated. Oregano

oil showed great in vitro activity against the strains

of Xanthomonas used in this study, with MICs

averaging 0.01 mg/ml. Surprisingly, the oregano

oil (with 30% carvacrol content) was significantly

more potent than a commercial source of

carvacrol (98%), indicating that in oregano

essential oil there are other components that work

synergistically with carvacrol. This study is the

first to show the effectiveness of oregano oil in

controlling bacterial spot disease in peppers, and

emphasizes the importance of natural treatments

in crop production that could replace toxic and

ineffective alternatives.

pepper plants with foliar applications of ammonium

lignosulfonate and potassium phosphate. Plant Disease.

8

6(11): 1232-1236.

ADAMS, R.P. 2001. Identification of essential oil components by

gas chromatography/quadrupole mass spectroscopy. Allured

Publishing Corporation, Carol Stream, Illinois. 175 p.

ALVAREZ, A.M., A.A. Benedict, and C.Y. Mizumoto. 1985.

Identification of xanthomonads and grouping of strains of

Xanthomonas campestris pv. campestris with monoclonal

antibodies. Phytopathology. 75(6): 722-728.

ANDRADE, E., L.P. Silva, J.L. Pereira, E.F. Noronha, F.B. Reis, C.

Bloch, M.F. Dos Santos, G.B. Domont, O.L. Franco, and A.

Mehta. 2008. In vivo proteome analysis of Xanthomonas

campestris in the interaction with the host plant Brassica

oleracea. FEMS. 28(2):167-174.

ARCILA-LOZANO, C., G. Loarca-Pina and S. Lecona-Uribe. 2004. El

orégano: propiedades, composición y actividad biológica de

sus componentes. ALAN. 54(1):100-111. ISSN 0004-0622.

AURELI, P., A. Costantini and S. Zolea. 1992. Antimicrobial activity

of some essential oils against Lysteria monocytogenes. Food

Protection 55(5):334-348.

BARICEVIC, D., L. Milevoj and J. Borstnik. 2001. Insecticidal effect of

oregano (Origanum vulgare) on the dry bean weevil

Acanthoscelides obtectus. Horticultural Science. 7(2):84-88.

Conclusions

The phytopathogen X. euvesicatoria was

identified by a simple method in infected seeds

and leaves of jalapeno. We examined the

antibacterial activity of oregano oil against strains

of X. euvesicatoria from different origins. The

susceptibility of the plant pathogen was more

remarkable in the seed treatment, but it was also

efficient in higher concentrations when a foliar

application was performed. Among the

antimicrobial compounds identified, carvacrol

predominated in the oil composition; however,

when antibacterial test were performed with pure

carvacrol, oregano oil demonstrated a higher

antibacterial activity. Mexican oregano oil has

proven to be effective and it is a potential

candidate for future studies of synergism,

compatibility and activity in other pathogens

BIONDI, D., P. Cianci, C. Geraci, G. Ruberto and M. Piattelli. 1993.

Antimicrobial activity and chemical composition of essential

oils from Sicilian aromatic plants. Flavour and fragrance.

8(6):331-337.

BOGDANOVE, A.J., Koebnik, R., Lu, H., Furutani, A., Angiuoli, S.V.,

Patil, P.B., Van Sluys, M.A., Ryan, R.P., Meyer, D.F., Han, S.W.,

Aparna, G., Rajaram, M., Delcher,A.L., Phillippy,A.M., Puiu, D.,

Schatz, M.C., Shumway, M., Sommer, D.D., Trapnell, C.,

Benahmed, F., Dimitrov, G., Madupu, R., Radune, D., Sullivan,

S., Jha, G., Ishihara, H., Lee, S.W., Pandey, A., Sharma, V.,

Sriariyanun, M., Szurek, B., Vera-Cruz, C.M., Dorman, K.S.,

Ronald, P.C., Verdier, V., Dow, J.M., Sonti, R.V., Tsuge, S.,

Brendel, V.P., Rabinowicz, P.D., Leach, J.E., White, F.F., and

Salzberg, S.L. (2011). Two new complete genome sequences

offer insight into host and tissue specificity of plant pathogenic

Xanthomonas spp.Journal of Bacteriology. 193: 5450-5464

BOUZAR, H., J.B. Jones, R.E. Stall, N.C. Hodge, G.V. Minsavage,

A.A. Benedict andA.M.Alvarez. 1994. Physiological, chemical,

serological and pathogenic analyses of a worldwide collection

of Xantomonas campestris pv. vesicatoria strains.

Phytopathology. 84(22): 663-671.

(human, plant or animal).

Aknowledgements

CHORIANOUPOLOS, N., E. Kalpoutzakis, N. Aligiannis, S. Mitaku, G.J.

Nychas andA.S. Haroutounian. 2004. Essential oils of Satureja,

Origanum, and Thymus species: chemical composition and

antibacterial activities against foodborne pathogens.

Agricultural and Food Chemistry 52(26): 8261-7.

CHORIANOUPOLOS, N., E. Evergetis,A. Mallouchos, E. Kalpoutzakis,

G.J. Nichas and A.S. Haroutonian. 2006. Characterization of

the essential oil volatiles of Saruteja thymbra and Saruteja

parnassica: influence on harvesting time and antimicrobial

activity. Agricultural and Food Chemistry. 54(8): 3139-45.

CHUANG, T.Y., and M. Jeger. 1987. Relationship between incidence

and severity of banana leaf spot in Taiwan. Phytopathology

We thank Bertha Rivas-Lucero, Stephen

Hanson, Andrea Colleman, Rio Stamler, Jeanne

Curry, Richard Richins and Mary O’Connell for

valuable help in biochemical, microbiological and

molecular techniques. We acknowledge Paul

Bosland and the Chile pepper institute for providing

uninfected pepper seeds (early variety). We also

thank the Pablo Licon industry for providing high

quality oregano essential oil for this study.

77: 1537-1541.

1

19

•

Vol. VIII, Núm. 2 • Mayo-Agosto 2014 •

ALBA CHAVEZ-DOZAL, HUGO A. MORALES-MORALES, SOUM SANOGO, ARMANDO SEGOVIA-LERMA AND GEOFFREY B. SMITH: Antibacterial activity of

mexican oregano essential oil (Lippia berlandieri) against the phytopathogenic bacterium Xanthomonas euvesicatoria

DORMAN, H.J., and S.G. Deans. 2000. Antimicrobial agents from

plants: antibacterial activity of plant volatile oils. Applied

Microbiology. 88(2): 308-16.

POHRONESNY, K., M.A. Moss, W. Dankers and J. Schenk. 1990.

Dispersal and management of Xanthomonas campestris pv

vesicatoria during thinning of direct-seed tomato. Plant

Disease 74:800-805.

DUSCHASTKI, C., P. Bailac, A. Carrascull, N. Firpo and M. Ponzi.

1

999. Composicion de los aceites esenciales de Lippia

PORTILLO-RUIZ, M., S. Viramontes, L. Munoz, M. Gastelum and G.V.

Nevarez. 2005. Antifungal activity of mexican oregano Lippia

berlandieri shauer. Food Protection 68(12):2713-2717.

jeneillana, L. integrifolia, L. Turbinata de la provincia de San

Luis en Argentina. Rev Colombiana de Química. 27:9-16.

ELGAYYAR, M., and F.A. Draughon. 2001. Antimicrobial activity of

essential oils from plants against selected pathogenic and

saprophytic microorganisms. Food Protection 64(7):1019-24.

FORCE, M., W.S. Sparks, and R.A. Ronzio. 2000. Inhibition of enteric

parasites by emulsified oil of oregano in vivo. Phytotheraphy

Research. 14(3): 213-4.

SANOGO, S., and M. Clary. 2008. Bacterial leaf spot of Chile

peppers: A short guide for growers. New Mexico Chile

Association Report. 40 p.

STOVER, R.H., and J.D. Dickson. 1970. Leaf spot on bananas caused

by Mycosparella musicola: Methods of measuring spotting

prevalence and severity. Tropical Agriculture. 47:289-302.

VALERO, M., and M.C. Salmeron. 2003. Antibacterial activity of 11

essential oils against Bacillus cereus in tyndallized carrot broth.

International Journal Food Microbiology. 85(1-2):73-81.

FRANKEN, A.A., J.F. Zilverentant, P.M. Boonekamp, andA. Schots.

1991. Specificity of polyclonal and monoclonat antibodies for

the identification of Xanthomonas campetris pv campestris.

European Plant Pathology. 98(2): 81-94.

FEDATTO, L.E. 2006. Detection and characterization of protease

secreted by the plant pathogen Xylella fastidiosa.

Microbiological Research. 161(3):263-272.

TREBAOL, G., Gardan L., Manceau C., Tanguy J., Tirilly Y., and

Boury S. 2000. Genomic and phenotypic characterization of

Xanthomonas cynarae sp. nov., a new species that causes

bacterial bract spot of artichoke (Cynara scolymus L.).

International Journal of Systematic and Evolutionary

Microbiology. 50:1471-1478.

JI-LIANG, Z., and C.S. Orser. 2004. Conserved repetition in the ice

nucleation gene inaX from Xanthomonas campestris pv.

transluscens. Molecular and General Genetics. 223(1):1432-

VELASQUEZ-VALLE, R., and M.D. Amador-Ramirez. 2007. Análisis

sobre la investigación fitopatogénica de chile seco (Capsicum

annuum L.), realizada por el Instituto Nacional de

Investigaciones Forestales, Agrícolas y Pecuarias de los

estados de Aguascalientes y Zacatecas, México. Revista

Mexicana de Fitopatología. 25(1): 80-84.

VELDHUZEN, E.J.A., B. Tjeerdsma-Van, C. Zweijtzer, S.A. Burt and

H.P. Haagsman. 2006. Structural requirements for the

antimicrobial activity of carvacrol. Agricultural and Food

Chemistry 54: 1874-1879.

VERNIN, G., C. Lageot, E.M. Gaydouz and C. Parkanyi. 2001.

Analysis of the essential oil of Lippia graveolens from El

Salvador. Flavor and Fragrance. 16: 219-226.

1

874.

KUFLOM, M. K., andA.C. Diane. 1997. Development of a Diagnostic

DNA Probe for Xanthomonads Causing Bacterial Spot of

Peppers and Tomatoes. Applied and Environmental

Microbiology 63(11): 4462-4470.

O’MAHONY, R., H. Al-Khtheeri, D. Weerasekera, N. Fernando, D.

Vaira, J. Holton, and C. Basset. 2005. Bactericidal and anti-

adhesive properties of culinary and medicinal plants against

Helicobacter pylori. World Journal of Gastroenterol. 11(47):

VORHOLTER, F.J., S. Schneiker, A. Goesmann, L. Krause, T. Bekel,

O. Kraiser, B. Linke, T. Patshkowski, C. Ruckert, J. Schmid, K.

Sidhuv, V. Sieber,A. Tauch, S.A. Watt, B. Weisshaar,A. Becker,

K. Niehaus andA. Puhler. 2008. The genome of Xanthomonas

campestris pv. campestris and its use for the reconstruction

of methabolic pathways involved in xanthan biosynthesis.

Biotechnology 134(1-2):33-45.

7

499-507.

Este artículo es citado así:

Chavez-Dozal, A., H. A. Morales-Morales, S. Sanogo,A. Segovia-Lerma and G. B. Smith. 2014. Antibacterial

activity of mexican oregano essential oil (Lippia berlandieri) against the phytopathogenic bacterium

Xanthomonas euvesicatoria. TECNOCIENCIA Chihuahua 8(2): 109-121.

1

20

• Vol. VIII, Núm. 2 • Mayo-Agosto 2014 •

ALBA CHAVEZ-DOZAL, HUGO A. MORALES-MORALES, SOUM SANOGO, ARMANDO SEGOVIA-LERMA AND GEOFFREY B. SMITH: Antibacterial activity of

mexican oregano essential oil (Lippia berlandieri) against the phytopathogenic bacterium Xanthomonas euvesicatoria

Resumen curricular del autor y coautores

GEOFFREY BATTLE SMITH. Realizó sus estudios de licenciatura en Biología e Inglés en el Pitzer College, en Claremont, California, USA.

Obtuvo su grado de maestría en ciencias en la University of Kentucky, y su grado doctoral en Ciencias de Suelos en North Carolina

State University. Posee un grado post-doctoral de la Michigan State University. Inició como profesor de Microbiología en la New

Mexico State Universtiy (NMSU) en 1991, en donde imparte las asignaturas de Microbiología General y Microbiología Ambiental.

Realizó un año sabático en 1996 en la Universidad Autónoma de Guadalajara, Jalisco, México donde trabajó en el campo de

biorremediación. Como asesor principal de tesis, ha supervisado y graduado a diez estudiantes doctorales y a veintidós de

maestría en ciencias, con quienes ha publicado diversos artículos científicos relativos a la recuperación de suelos por biorremediación

y monitoreo de variables ambientales microbiológicas de gran importancia para la sanitización de agua y suelos contaminados con

microorganismos patógenos y compuestos tóxicos. Es miembro de varias sociedades científicas como la Sociedad Americana de

Microbiología (ASM), USA, desde 1997 a la fecha. Es el líder desde 2005 de la red internacional de colaboración con el Cuerpo

Académico UACH-CA-100 "Transferencia Tecnológica" adscrito a la Universidad Autónoma de Chihuahua, con quienes ha

compartido la co-autoría en diversos temas para la su publicación en reuniones científicas. Actualmente realiza actividades de

colaboración internacional en la validación de las propiedades antimicrobianas de extractos vegetales para su aplicación en la

agricultura sustentable.

SOUM SANOGO. El Dr. Sanogo es Profesor Asociado del Departamento de Entomología, Patología y Malezas en la New Mexico State

University, Las Cruces, NM. Graduado en Pennsylvania State University. Su línea de investigación es la etiología de enfermedades,

ecología y epidemiología de patógenos del suelo, especialmente hongos y oomycetos, así como control de enfermedades, incluyendo

biofungicidas, uso de extractos vegetales y pruebas de resistencia a enfermedades. El Dr. Sanogo trabaja cultivos como chile,

cacahuate, alfalfa y otros de menor cobertura en el Estado de Nuevo México, imparte dos asignaturas "Biología de hongos" y

"diagnóstico de enfermedades vegetales". Es autor principal en varios artículos científicos y pertenece a diferentes sociedades

científicas de su área, como la American Phytopathological Society, Crop Science Society of America y la American Peanut

Research and Education Society. Es miembro de la red internacional de colaboración con el Cuerpo Académico UACH-CA-100

"Transferencia Tecnológica" adscrito a la Universidad Autónoma de Chihuahua, con quienes ha compartido la co-autoría en

diversos temas para la su publicación. Actualmente realiza actividades de colaboración internacional con el UACH-CA-100 en la

validación de las propiedades antimicrobianas de extractos vegetales para su aplicación en la agricultura sustentable en cultivos

hortícolas de Nuevo México, USA y en la Región Centro-sur de Chihuahua.

ALBA ARCELIA CHÁVEZ DOZAL. Terminó su licenciatura en el año de 2004, titulándose como Química Bacterióloga Parasitóloga por la

Facultad de Ciencias Químicas de la Universidad Autónoma de Chihuahua (UACH). Realizó su posgrado en Estados Unidos en la

Universidad Estatal de Nuevo México (NMSU), donde obtuvo el grado de Maestro en Ciencias en el área Microbiología en 2008 y el

de Doctorado en 2012. Su área de especialización es la genética bacteriana específicamente dirigida a desarrollo de infecciones.

Ha asesorado y dirigido 4 tesis de licenciatura y ha publicado 6 artículos científicos; ha impartido tres clases de Microbiología Médica

y presentado su investigación en 15 conferencias nacionales e internacionales. Es miembro activo de la Asociación Americana de

Microbiología y ha sido reconocida y apoyada por asociaciones nacionales como "RISE for the postdoctorate", "The Society for

Advancing Chicanos and Native Americans in Science (SACNAS)" y "National Aeronautics and Space Administration (NASA)".

ARMANDO SEGOVIA LERMA. En el año 1984, obtuvo el título de Ingeniero Agrónomo Fitotecnista por la Facultad de Ciencias Agrícolas y

Forestales (FCAyF) de la Universidad Autónoma de Chihuahua (UACH). Le fue conferido el grado de Maestro en Ciencias,

especialidad Genética, por el Colegio de Posgraduados de Chapingo, México (hoy COLPOS, Montecillo, Estado de México). Realizó

estudios de doctorado en la Universidad Estatal de Nuevo México (NMSU) recibiendo en el año 2000 su grado de Doctor of

Philosophy con especialidad en Mejoramiento Genético. El Dr. Segovia fundó en 1989 el Programa de Mejoramiento Genético de

Hortalizas de la FCAyF-UACH, donde dirige la línea de investigación "Mejoramiento Genético y Producción de Semillas de Hortalizas".

Es obtentor de la variedad de cebolla de día corto "Mariana-UACH-92" y de variedades de: sandía, chiles para consumo en seco y

jalapeño (en trámite de registro ante SNICS-SAGARPA). Por su desempeño profesional, como Maestro e Investigador a favor del

Agro Chihuahuense, recibió un reconocimiento de la Confederación Mexicana Agronómica y el Colegio de Ingenieros Agrónomos de

Chihuahua. Durante el periodo 1991-1994, recibió el reconocimiento como Candidato a Investigador por el Sistema Nacional de

Investigadores (S.N.I.) y como Investigador Nivel I desde el año 2006. El Dr. Segovia es Maestro de Tiempo Completo de la FCAyF

donde ha impartido cursos de Genética y Estadística en licenciatura y posgrado.

HUGO ARMANDO MORALES MORALES. Cursó la licenciatura en la Facultad de CienciasAgrícolas de la UniversidadAutónoma de Chihuahua

(

UACH), otorgándosele en 1984 el título de Ingeniero Agrónomo, especialidad Fitotecnia. Realizó estudios de posgrado en la

Facultad de Ciencias Agrícolas y Forestales de la UACH, obteniendo en el año de 1997 el grado de Maestro en Ciencias en la

especialidad de Horticultura y Agronegocios. Posee el Doctorado en Ciencias Biológicas, con un mayor en Microbiología Ambiental,

grado conferido en 2003 por New Mexico State University NMSU), USA. Desde el año 1984 se desempeña como Maestro de Tiempo

Completo en la UACH y ha sido miembro del CuerpoAcadémico Transferencia de Tecnología desde 2006, año a partir del cual recibió

el reconocimiento como Perfil PROMEP. Colabora en un proyecto de investigación bilateral en red con investigadores de la New

Mexico State University desde el año 2005; además, cultiva la línea de investigación: "Agricultura sustentable" y es responsable

técnico de varios proyectos de investigación con financiamiento externo (Fundación Produce, FOMIX Chihuahua, UACH). A lo largo

de su vida profesional ha participado como ponente en congresos científicos nacionales e internacionales, y publicado como autor

y coautor, varios artículos en revistas científicas y de divulgación.

1

21

•

Vol. VIII, Núm. 2 • Mayo-Agosto 2014 •